CD Genomics Blog

Explore the blog we’ve developed, including genomic education, genomic technologies, genomic advances, and genomics news & views.

What is 18S rRNA?

18S ribosomal RNA (18S rRNA) is a component of the small eukaryotic ribosomal subunit (40S), and 40S and 60S constitute eukaryotic ribosomes. As a structural RNA for eukaryotic ribosomes, 18S rRNA, the homologue of 16S rRNA in prokaryotes and mitochondria, is thus one of the essential components of all eukaryotic cells. 18S rRNA genes that code for 18S rRNA are widely used in phylogenetic analysis and environmental biodiversity screening.

1

 

Figure 1. Prokaryotic 70S ribosome and eukaryotic 80S ribosome.

18S rRNA as a marker for biodiversity studies

18S rRNA gene is a common molecular marker for biodiversity studies since it is highly conserved intra-species (similarities close to 100%) and assist in species-level analyses. Similar to 16S rRNA, 18S rRNA gene has nine variable regions (V1-V9). Previous studies tested the taxonomic resolutions of 18S rRNA gene at different taxonomic levels (Wu et al. 2015) come to the following conclusions: i. full-length 18S rRNA sequences or partial regions (around V2, V4, and V9) of the 18S rRNA gene are useful for the discrimination of samples at both the family and order levels; ii. V9 has a higher resolution at the genus level; iii. V4 is the most divergent region in length, which would be a marker candidate for the phylogenetic study of Acartia speicies.

Once we obtained 18S rRNA sequences, they could be used for taxonomic resolutions and diversity analysis in eukaryotic communities. While 16S rRNA gene sequencing provides insight into bacterial diversity, 18S rRNA gene sequencing can offer insight into fungal diversity. Taxonomic structure of prokaryotic and eukaryotic microbial communities can be determined via 16S and 18S rRNA gene sequencing. It is crucial to understand the ecological niches that contribute to environmental pathogen development.

What is the difference between 18S rRNA and ITS in metagenomic analysis?

ITS (internal transcribed spacer region) is located between the 18S and 5.8S rRNA genes and has a high degree of sequence variation. Similar to 18S rRNA, ITS is often used in metagenomic analysis. However, 18S rRNA is mainly used for high resolution taxonomic studies of fungi, while the ITS region is mainly used for fungal diversity studies as a fungal barcode marker. Compared to 18S, ITS is more variable and thereby, more suitable as the genetic marker to measure intraspecific genetic diversity.

2

Figure 2. Schematic diagram of the eukaryotic rRNA genes.

Primers for 18S rRNA

There are many available primers for 18S rRNA as shown in Table 1. With primers NS1 and NS8, we can obtain a greater length than 1,600 bp (the full-length of 18S rRNA is approximately 1800 bp). Alternatively, 18S rRNA sequences available in databases such as Silva (https://www.arb-silva.de/) and EukRef (http://eukref.org/) can be used for primer design.

Table 1. Primers for 18S rRNA (from Berkeley university of California).

Name Primer Sequence Tm
NS1 GTAGTCATATGCTTGTCTC 49
CNS1 GAGACAAGCATATGACTACTG 55
NS2 GGCTGCTGGCACCAGACTTGC 65
NS3 GCAAGTCTGGTGCCAGCAGCC 65
NS4 CTTCCGTCAATTCCTTTAAG {62}
NS5 AACTTAAAGGAATTGACGGAAG 55
NS6 GCATCACAGACCTGTTATTGCCTC {72}
NS7 GAGGCAATAACAGGTCTGTGATGC {72}
NS8 TCCGCAGGTTCACCTACGGA 59
TW9 TAAGCCATGCATGTCT  
TW10 GCGGTAATTCCAGCTCC  
TW11 GGAGTGGAGCCTGCGGCT  
TW12 AAGTCGTAACAAGGTTT 53
CTW12 AAACCTTGTTACGACTT 53
NS17 CATGTCTAAGTTTAAGCAA 55
NS18 CTCATTCCAATTACAAGACC 60
NS19 CCGGAGAAGGAGCCTGAGAAAC 74
NS20 CGTCCCTATTAATCATTACG 61
NS21-ag GAATAATAGAATAGGACG 50
NS21-ls AATATACGCTATTGGAGCTGG  
NS22 AATTAAGCAGACAAATCACT 57
NS23 GACTCAACACGGGAAACTC 64
NS24 AAACCTTGTTACGACTTTTA 58
NS25 GTGGTAATTCTAGAGCTAATACT  
CNS25 ATGTATTAGCTCTAGAATTACCAC  
NS26 CTGCCCTATCAACTTTCGA  
CNS26 TCGAAAGTTGATAGGGCAG  
VANS1 GTCTAGTATAATCGTTATACAGG 57
MB1 GGAGTATGGTCGCAAGGCTG  
CMB1 CAGCCTTGCGACCATACTCC  
MB2 GTGAGTTTCCCCGTGTTGAG 57
Basid 1 TTGCTACATGGATAACTGTG 49
Basid 2 CTGTTAAGACTACAACGG  
Basid 3 AGAGTGTTCAAAGCAGGC  
Basid 4 CTCACTAAGCCATTCAATCGG  
NS1.5R TCTAGAGCTAATACATGC(T/C)G 52
NS2.8R GGCCCTCAAATCTAAGGATT 53
CNS2.8R AATTTGCGCGCCTGCTGCAA 57
NS3.2R CGTATATTAAAATTGTTGAC 45
CNS3.3R GACTACGAGCTTTTTAACGT 51
CNS3.5R TTTCGCAGTAGTTTGTCTTA 49
NS3.6R CAAACTACTGCGAAAGCATC 53
CNS3.6R AATGAAGTCATCCTTGGCAG 53

CD Genomics stands ready to provide reliable 18S characterization services, including 16S/18S/ITS amplicon sequencing by NGS and full-length 16S/18S/ITS sequencing by PacBio SMRT technology. Please contact our scientists for more detailed information.

References:

  1. Berkeley university of California (https://nature.berkeley.edu/brunslab/tour/primers.html#18s)
  2. Buse H Y, Lu J, Lu X, et al. Microbial diversities (16S and 18S rRNA gene pyrosequencing) and environmental pathogens within drinking water biofilms grown on the common premise plumbing materials unplasticized polyvinylchloride and copper. FEMS microbiology ecology, 2014, 88(2): 280-295.
  3. Wu S, Xiong J, Yu Y. Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda. PloS one, 2015, 10(6): e0131498.
Tagged with:

Leave a Reply

Your email address will not be published. Required fields are marked *