CD-2019-nCoV-abEN can be utilized as a positive control for viral RNA extraction experiments and qPCR tests. Retrovirus envelope and nucleic acid sequences make up the pseudovirus. Chemical synthesis is used to acquire nucleic acid from the ORF1a/b gene sequence, Gene E, and Gene N coding area sequence of 2019-nCoV, which is then duplicated into a retrovirus vector. The pseudovirus was grown in 293T cells before being concentrated and purified using ultra-fast centrifugation.
Application:
It can be used as a positive control for viral RNA extraction experiment and qPCR test.
Components:
*The main ingredients including glucose, potassium dihydrogen phosphate, disodium phosphate, sodium chloride, potassium chloride, and CD-2019-nCoV-abEN pseudoviruses.
Structure and sequences:
1. ORF1 a/b SEQ
ATCGTGTTGTCTGTACTGCCGTTGCCACATAGATCATCCAAATCCTAAAGGATTTTGTGACTTAAAAGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTTTACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCAGTCAGCTGATGCACAATCGTTTTTAAACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCACAGGCACTAGTACTGATGTCGTATACAGGGCTTTTGACATCTACAATGATAAAGTAGCTGGTTTTGCTAAATTCCTAAAAACTAATTGTTGTCGCTTCCAAGAAAAGGACGAAGATGACAATTTAATTGATTCTTACTTTGTAGTTAAGAGACACACTTTCTCTAACTACCAAC ATGAAGAAACAATTTATAATTTACTTAAGGATTGTCCAGCTGTTGCTAAACAT
2. E Gene SEQ
ATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACCTTCTTTTTACGTTTACTCTCGTGTTAAAAATCTGAATTCTTCTAGAGTTCCTGATCTTCTGGTCTAA
3. N Gene SEQ
ATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCCAAGGTTTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCGAGGACAAGGCGTTCCAATTAACACCAATAGCAGTCCAGATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGGTGGTGACGGTAAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGCTGGACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTAACTCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAAGAAGCCTCGGCAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCCAAGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGCCATCAAATTGGATGACAAAGATCСAAATTTCAAAGATCAAGTCATTTTGCTGAATAAGCATATTGACGCATACAAAACATTCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAGAAGGCTGATGAAACTCAAGCCTTACCGCAGAGACAGAAGAAACAGCAAACTGTGACTCTTCTTCCTGCTGCAGATTTGGATGATTTCTCCAAACAATTGCAACAATCCATGAGCAGTGCTGACTCAACTC AGGCCTAA
Storage:
The components should be stored at -20°C and is stable for 6 months.
Specifications:
| Application | It can be used as a positive control for viral RNA extraction experiment and qPCR test. |
Virus Extraction Kits
| Cat. No. | Product Name | Specs | |
|---|---|---|---|
| DCE008 | CD Viral DNA&RNA Kit | 50 | View product page |
| DCE102 | CD Magnetic Viral DNA&RNA Kit | 50 / 200 | View product page |
Positive Control
| Cat. No. | Product Name | Specs | |
|---|---|---|---|
| MD002 | CD-2019-nCoV-abn | 1ml / 5ml / 10ml | View product page |
One Step qRT-PCR Kits
| Cat. No. | Product Name | Specs | |
|---|---|---|---|
| QRT001 | CD One Step qRT-PCR SYBR Green Kit | 250 / 100 | View product page |
| QRT002 | CD One Step qRT-PCR Probe Kit | 250 / 100 | View product page |
NGS Metagenome Preparation Kits
| Cat. No. | Product Name | Specs | |
|---|---|---|---|
| DP001 | CD Universal DNA Library Prep Kit for Illumina | 24 / 96 / 24(PCR-free) / 96(PCR-free) | View product page |
| DP002 | CD NEXT DNA Library Prep Kit for Illumina | 24(50ng) / 96(50ng) / 24(5ng) / 96(5ng) / 24(1ng) / 96(1ng) | View product page |
| CB001 | CD DNA Clean Beads | 5ml / 60ml / 450ml | View product page |
| DSI001 | CD DNA Adapters S1-S2 for Illumina | 48 / 192 / 48 / 192 | View product page |
| DSI002 | CD DNA Adapters S3-S6 for Illumina | 192 / 192 / 192 / 192 | View product page |
| DDI001 | CD Multiplex Oligos S1 for Illumina | 192 | View product page |
| DDI002 | CD Multiplex Oligos S2 for Illumina | 192 | View product page |
| DDI003 | CD NEXT Index Kit S1 for Illumina | 192 | View product page |
| DDI004 | CD NEXT Index Kit S2 for Illumina | 768 | View product page |
| DDI005 | CD NEXT Index Kit S3 for Illumina | 192 / 192 / 192 / 192 | View product page |
- Melting of pseudovirus: remove the pseudovirus from the refrigerator at -20°C, melt it in an ice bath or put it in 4 °C, and then conduct the experimental operations after it has completely melted;
- Inactivation (optional) of pseudovirus: absorb the required amount of pseudovirus in the biological safety cabin and inactivate it in the EP tube at 56°C for 30min;
- RNA extraction and qPCR detection of pseudovirus: carry out relevant experimental operations according to the instructions of nucleic acid extraction kit and qPCR detection kit.
- (optional) There may be a small amount of plasmid DNA residue in this product. For experiments with high purity requirements, DNase-DEPC-H2O can be used for RNA dissolution and elution during RNA extraction. Then add EDTA (5mM), incubate for 10min at 75℃ to inactivate DNase enzyme.
Notes:
- Repeated freezing-thawing should be avoided. Freezing-thawing will reduce the stability of the pseudovirus, thus affecting the effect of nucleic acid extraction and qPCR test results;
- Inactivation of pseudovirus may lead to the degradation of RNA. Please make a reasonable choice according to the experimental requirements.
- If the product needs to be diluted, phosphate buffer (PBS) or normal saline (0.9% NaCl) can be used;
- In case of accidental splash to eyes, skin or other body parts, please immediately rinse with plenty of water;
- The experimental wastes generated by the use of this product shall be treated according to the requirements of medical waste treatment after high-pressure sterilization.