CD-2019-nCoV-abEN

CAT Specs Inquiry Basket
MD003-01 1ml
MD003-02 5ml
MD003-03 10ml

The pseudovirus is composed of retrovirus envelope and nucleic acid sequences. The nucleic acid, which is a part of the ORF1a/b gene sequence, Gene E and Gene N coding region sequence of 2019-nCoV, is obtained by chemical synthesis and cloned into a retrovirus vector. The pseudovirus was prepared in 293T cells, and then concentrated and purified by ultra-fast centrifugation. CD-2019-nCoV-abEN can be used as a positive control for viral RNA extraction experiment and qPCR test.

CD-2019-nCoV-abEN can be utilized as a positive control for viral RNA extraction experiments and qPCR tests. Retrovirus envelope and nucleic acid sequences make up the pseudovirus. Chemical synthesis is used to acquire nucleic acid from the ORF1a/b gene sequence, Gene E, and Gene N coding area sequence of 2019-nCoV, which is then duplicated into a retrovirus vector. The pseudovirus was grown in 293T cells before being concentrated and purified using ultra-fast centrifugation.

Application:

It can be used as a positive control for viral RNA extraction experiment and qPCR test.

Components:

Components

*The main ingredients including glucose, potassium dihydrogen phosphate, disodium phosphate, sodium chloride, potassium chloride, and CD-2019-nCoV-abEN pseudoviruses.

Structure and sequences:

Structure and sequences

1. ORF1 a/b SEQ

ATCGTGTTGTCTGTACTGCCGTTGCCACATAGATCATCCAAATCCTAAAGGATTTTGTGACTTAAAAGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTTTACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCAGTCAGCTGATGCACAATCGTTTTTAAACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCACAGGCACTAGTACTGATGTCGTATACAGGGCTTTTGACATCTACAATGATAAAGTAGCTGGTTTTGCTAAATTCCTAAAAACTAATTGTTGTCGCTTCCAAGAAAAGGACGAAGATGACAATTTAATTGATTCTTACTTTGTAGTTAAGAGACACACTTTCTCTAACTACCAAC ATGAAGAAACAATTTATAATTTACTTAAGGATTGTCCAGCTGTTGCTAAACAT

2. E Gene SEQ

ATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACCTTCTTTTTACGTTTACTCTCGTGTTAAAAATCTGAATTCTTCTAGAGTTCCTGATCTTCTGGTCTAA

3. N Gene SEQ

ATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCCAAGGTTTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCGAGGACAAGGCGTTCCAATTAACACCAATAGCAGTCCAGATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGGTGGTGACGGTAAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGCTGGACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTAACTCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAAGAAGCCTCGGCAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCCAAGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGCCATCAAATTGGATGACAAAGATCСAAATTTCAAAGATCAAGTCATTTTGCTGAATAAGCATATTGACGCATACAAAACATTCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAGAAGGCTGATGAAACTCAAGCCTTACCGCAGAGACAGAAGAAACAGCAAACTGTGACTCTTCTTCCTGCTGCAGATTTGGATGATTTCTCCAAACAATTGCAACAATCCATGAGCAGTGCTGACTCAACTC AGGCCTAA

Storage:

The components should be stored at -20°C and is stable for 6 months.

Specifications:

Application It can be used as a positive control for viral RNA extraction experiment and qPCR test.

Related Products

Virus Extraction Kits

Cat. No. Product Name Specs
DCE008 CD Viral DNA&RNA Kit 50 View product page
DCE102 CD Magnetic Viral DNA&RNA Kit 50 / 200 View product page

Positive Control

Cat. No. Product Name Specs
MD002 CD-2019-nCoV-abn 1ml / 5ml / 10ml View product page

One Step qRT-PCR Kits

Cat. No. Product Name Specs
QRT001 CD One Step qRT-PCR SYBR Green Kit 250 / 100 View product page
QRT002 CD One Step qRT-PCR Probe Kit 250 / 100 View product page

NGS Metagenome Preparation Kits

Cat. No. Product Name Specs
DP001 CD Universal DNA Library Prep Kit for Illumina 24 / 96 / 24(PCR-free) / 96(PCR-free) View product page
DP002 CD NEXT DNA Library Prep Kit for Illumina 24(50ng) / 96(50ng) / 24(5ng) / 96(5ng) / 24(1ng) / 96(1ng) View product page
CB001 CD DNA Clean Beads 5ml / 60ml / 450ml View product page
DSI001 CD DNA Adapters S1-S2 for Illumina 48 / 192 / 48 / 192 View product page
DSI002 CD DNA Adapters S3-S6 for Illumina 192 / 192 / 192 / 192 View product page
DDI001 CD Multiplex Oligos S1 for Illumina 192 View product page
DDI002 CD Multiplex Oligos S2 for Illumina 192 View product page
DDI003 CD NEXT Index Kit S1 for Illumina 192 View product page
DDI004 CD NEXT Index Kit S2 for Illumina 768 View product page
DDI005 CD NEXT Index Kit S3 for Illumina 192 / 192 / 192 / 192 View product page
  1. Melting of pseudovirus: remove the pseudovirus from the refrigerator at -20°C, melt it in an ice bath or put it in 4 °C, and then conduct the experimental operations after it has completely melted;
  2. Inactivation (optional) of pseudovirus: absorb the required amount of pseudovirus in the biological safety cabin and inactivate it in the EP tube at 56°C for 30min;
  3. RNA extraction and qPCR detection of pseudovirus: carry out relevant experimental operations according to the instructions of nucleic acid extraction kit and qPCR detection kit.
  4. (optional) There may be a small amount of plasmid DNA residue in this product. For experiments with high purity requirements, DNase-DEPC-H2O can be used for RNA dissolution and elution during RNA extraction. Then add EDTA (5mM), incubate for 10min at 75℃ to inactivate DNase enzyme.

Notes:

  1. Repeated freezing-thawing should be avoided. Freezing-thawing will reduce the stability of the pseudovirus, thus affecting the effect of nucleic acid extraction and qPCR test results;
  2. Inactivation of pseudovirus may lead to the degradation of RNA. Please make a reasonable choice according to the experimental requirements.
  3. If the product needs to be diluted, phosphate buffer (PBS) or normal saline (0.9% NaCl) can be used;
  4. In case of accidental splash to eyes, skin or other body parts, please immediately rinse with plenty of water;
  5. The experimental wastes generated by the use of this product shall be treated according to the requirements of medical waste treatment after high-pressure sterilization.

* For Research Use Only. Not for use in diagnostic procedures.

  • For research purposes only, not intended for clinical diagnosis, treatment, or individual health assessments.

We provide high-quality kit products for researchers from across the world, meeting the needs of various nucleic acid-related experiments.

Copyright © CD Genomics. All rights reserved.
Top
0
Inquiry Basket