CD NEXT Index Kit S1 for Illumina

CAT Specs Inquiry Basket
DDI003 192

CD NEXT Index Kit S1 for Illumina is specially designed for CD NEXT DNA Library Prep Kit. The kit contains 8 kinds of 8bp indexed N5XX and 12 kinds of 8bp indexed N7XX. The dual-indexed adapter can be used to distinguish different samples. All Kit components are subjected to stringent quality control. Library Structure: 5’AATGATACGGCGACCACCGAGATCTACACIIIIIIIITCGTCGGCAGCGTCAGATGTGTATAAGAGACAG- Insert DNA Sequence -CTGTCTCTTATACACATCTCCGAGCCCACGAGACIIIIIIIIATCTCGTATGCCGTCTTCTGCTTG-3’

The CD NEXT Index Kit S1 for Illumina was created specifically for the CD NEXT DNA Library Prep Kit. It comes with eight different types of N5XX and twelve different types of N7XX that can be combined to make 96 different dual-indexed adapter combinations. All reagents in the kit undergo rigorous quality control and functional verification to maximize the stability and repeatability of library construction.

Components:

Components of CD NEXT Index Kit S1 for Illumina
Components of CD NEXT Index Kit S1 for Illumina

Application:

Special for CD NEXT DNA Library Prep Kit for Illumina (DP002), providing 96 kinds of different dual-indexed adapter combinations.

Storage:

All the components should be stored at -20℃.

Specifications:

Application Used for CD NEXT DNA Library Prep Kit for Illumina
Sequencing Platform Illumina

Strategy of Index Selection

Green fluorescent labeled dG/dT and red fluorescent labeled dC/dA were used in Illumina. To ensure successful sequencing, both green and red fluorescent signal must be detected in each sequencing cycle. Therefore, it is important to keep balance of the green and red fluorescence signals when choosing the Indices.

For the recommended combination of the Indices, please download the support document for CD NEXT Index Kit S1 for Illumina. You can check the sequence of each index and make sure that there are two kinds of fluorescence signals at each base position. You can also find examples in the handbook.

Quality Control

16-Hour Incubation: A 50 ul reaction system containing 5 ul of Oligos and 1 μg of Hind III-λ DNA incubated at 37 °C for 16 hours resulted in no band degraded detected by agarose gel electrophoresis. A 50 μl reaction system containing 5 ul of Oligos and 1 μg of T3 DNA incubated at 37 °C for 16 hours resulted in no band degraded detected by agarose gel electrophoresis.

Endonuclease Activity: A 50 ul reaction system containing 5 ul of Oligos and 1 ug of pX174RF I DNA incubated at 37°C for 4 hours resulted in < 10% conversion to RF Il analyzed by agarose gel electrophoresis.


* For Research Use Only. Not for use in diagnostic procedures.

Copyright © 2025 CD Genomics. All rights reserved.
Top
0
Inquiry Basket
There is no product in the inquiry basket.

We use cookies to understand how you use our site and to improve the overall user experience. This includes personalizing content and advertising. Read our Privacy Policy

Accept Cookies
x