CD NEXT Index Kit S2 for Illumina

CAT Specs Inquiry Basket
DDI004 768

CD NEXT Index Kit S2 for Illumina is specially designed for CD NEXT DNA Library Prep Kit. The kit contains 16 kinds of 8bp indexed i5 and 24 kinds of 8bp indexed i7. The dual-indexed adapter can be used to distinguish different samples. All Kit components are subjected to stringent quality control. Library Structure: 5’AATGATACGGCGACCACCGAGATCTACACIIIIIIIITCGTCGGCAGCGTCAGATGTGTATAAGAGACAG- Insert DNA Sequence -CTGTCTCTTATACACATCTCCGAGCCCACGAGACIIIIIIIIATCTCGTATGCCGTCTTCTGCTTG-3’

The CD NEXT Index Kit S2 for Illumina was created specifically for the CD NEXT DNA Library Prep Kit and is a quick, powerful, and cost-effective option for high-throughput applications. The kit includes 16 different types of 8bp indexed i5 and 24 different types of 8bp indexed i7. Various samples can be categorized using the dual-indexed adaptor. To optimize the stability and repeatability of library creation, all reagents in the kit are subjected to stringent quality control and functional testing.

Components:

Components of CD NEXT Index Kit S2 for Illumina
Components of CD NEXT Index Kit S2 for Illumina

Application:

Special for CD NEXT DNA Library Prep Kit for Illumina (DP002), providing 384 kinds of different dual-indexed adapter combinations.

Storage:

All the components should be stored at -20℃.

Specifications:

Application Used for CD NEXT DNA Library Prep Kit for Illumina
Sequencing Platform Illumina

Strategy of Index Selection

Green fluorescent labeled dG/dT and red fluorescent labeled dC/dA were used in Illumina. To ensure successful sequencing, both green and red fluorescent signal must be detected in each sequencing cycle. Therefore, it is important to keep balance of the green and red fluorescence signals when choosing the Indices.

For the recommended combination of the Indices, please download the support document for CD NEXT Index Kit S2 for Illumina. You can check the sequence of each index and make sure that there are two kinds of fluorescence signals at each base position. You can also find examples in the handbook.

Quality Control

16-Hour Incubation: A 50 ul reaction system containing 5 ul of Oligos and 1 μg of Hind III-λ DNA incubated at 37 °C for 16 hours resulted in no band degraded detected by agarose gel electrophoresis. A 50 μl reaction system containing 5 ul of Oligos and 1 μg of T3 DNA incubated at 37 °C for 16 hours resulted in no band degraded detected by agarose gel electrophoresis.

Endonuclease Activity: A 50 ul reaction system containing 5 ul of Oligos and 1 ug of pX174RF I DNA incubated at 37°C for 4 hours resulted in < 10% conversion to RF Il analyzed by agarose gel electrophoresis.


* For Research Use Only. Not for use in diagnostic procedures.

  • For research purposes only, not intended for clinical diagnosis, treatment, or individual health assessments.
0
Inquiry Basket