The CD Small RNA Index Primer Kit for Illumina was created specifically for the Illumina CD Small RNA Library Prep Kit. The kit includes everything you need to make small RNA libraries from total RNA. The kit allows multiplexed sequencing, allowing miRNA and small RNA discovery and profiling throughput to match Illumina sequencing's unrivaled output. There are four kits in the kit. Each kit includes a Universal Primer as well as 12 different 6bp indexed RNA primers that can be used to differentiate between samples.
Components:
Application:
Special for RNA library preparation for Illumina platforms with CD mRNA-seq Library Prep Kit for Illumina (RP001), CD Stranded mRNA-seq Library Prep Kit for Illumina (RP002) or CD Total RNA-seq Library Prep Kit for Illumina(human/mouse/rat) (RP003).
Storage:
All the components can be stored at -20℃ for one year.
Specifications:
| Application | Used for CD Small RNA Library Prep Kit for Illumina |
| Sequencing Platform | Illumina |
The corresponding sequences of small RNA Index are as follows:
| Index code | Index sequence | Index code | Index sequence | Index code | Index sequence | Index code | Index sequence |
| Index 1 | ATCACG | Index 13 | AGTCAA | Index 25 | ACTGAT | Index 37 | CGGAAT |
| Index 2 | CGATGT | Index 14 | AGTTCC | Index 26 | ATGAGC | Index 38 | CTAGCT |
| Index 3 | TTAGGC | Index 15 | ATGTCA | Index 27 | ATTCCT | Index 39 | CTATAC |
| Index 4 | TGACCA | Index 16 | CCGTCC | Index 28 | CAAAAG | Index 40 | CTCAGA |
| Index 5 | ACAGTG | Index 17 | GTAGAG | Index 29 | CAACTA | Index 41 | GACGAC |
| Index 6 | GCCAAT | Index 18 | GTCCGC | Index 30 | CACCGG | Index 42 | TAATCG |
| Index 7 | CAGATC | Index 19 | GTGAAA | Index 31 | CACGAT | Index 43 | TACAGC |
| Index 8 | ACTTGA | Index 20 | GTGGCC | Index 32 | CACTCA | Index 44 | TATAAT |
| Index 9 | GATCAG | Index 21 | GTTTCG | Index 33 | CAGGCG | Index 45 | TCATTC |
| Index 10 | TAGCTT | Index 22 | CGTACG | Index 34 | CATGGC | Index 46 | TCCCGA |
| Index 11 | GGCTAC | Index 23 | GAGTGG | Index 35 | CATTTT | Index 47 | TCGAAG |
| Index 12 | CTTGTA | Index 24 | GGTAGC | Index 36 | CCAACA | Index 48 | TCGGCA |
The structure of libraries prepared with CD Small RNA Library Prep Kit for Illumina is as follows:
AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATC——Insert——AGATCGGAAGAGCACACGTCTGAAC TCCAGTCACIIIIIIATCTCGTATGCCGTCTTCTGCTTG
*IIIIII indicates the index sequences (6 bp). Please input the related Index sequences of small RNA Adapters to the Sample Sheet before sequencing.
